SGN Marker TG111

SGN-M182

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
600
Vector
pUC
Cutting Site
SRD/PST1
Drug Resistance
AMP
Image
TG111 image not available
Forward sequence
GGGGGGGGGGTTCGATACACCCTTAGCTCAAGTAAAGCATTGTAAAATCAAGTAGGAAATGAAATATATTGAAGCAACAGCTGGGCATAC
ATCACCAAAACAAATTGCCAACCCGGACAAAGAATTGTGGTAATTTGGTTTTAATACGGTATTCAGGAGTAAAATTTCTGAATACGGTAT
TCGGTACAATATACTAATACCATTCGATATTCACTAGGATTCTTTTGCCCACCATTTCTTCCTAGAACACTGAACAATCACAATAGAATG
GTCGGACAAGCACCATCTAATCTGAGCCTGACTATCTCAAATCTCTAGTTTCAGATTCAATACTCTTTTATGATTTGTTTTCTTCCCTTT
TAATCTTCTTGTATAGAACTAATTTAGTTGTGGAAGAATCAAACCTTCTACCCTGATCCTCGACCTATATATTCCTATCTAGGGTCATAT
CCTCAGTAAGCTACAGCCTACAAGTGTCATGTCCTGTCTAATCACTTCCCCAATACTTCTTCGCATTTGGTGG
Reverse sequence
GGGGGGGGAGAAATATTATTAAACTTAACACTAGATACATTTTCCTTTTTCTTTTTTGAGTTTCTCCTTTCTATATAATCCACCAAATGC
GAAAAAGTATTGGGGAAGTGATTAAACAGGACATGACACTTGTAGGCTGTAGCTTACTGAGGATATGACCCTAAATAGGAATATATAGGT
CGAGGATCAGGGTAAAAGGTTTGATTCTTCCACAACTAAATTAGTTCTATACAAGAAGATTAAAAGGGAAGAAAACAAATCATAAAAGAG
TATTGAATCTGAAACTAAAGATTTGAGATAGTCAGGCTCAAATTAAATGGGGCTTGTCCGACCATTCTATTGTGATTGTTCAGGGTTCTA
GGAAAAAATGGGGGGCAAAAAAATCCTAGGGAATATCGAATGGTATTAGTATATTGTACCGAATACCGTATTCAAAAATTTTACTCCTGA
ATACCGTATTAAAACCAAATTACCACAATTCTTTGTCCGGGTTGGCAATTTGTTTTGGTGATGTATGCCCAGCTG
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53507)
Chromosome
12
Position
39.30 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50341)
Chromosome
12
Position
47.13 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48276)
Chromosome
12
Position
58.58 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Sun1642 x LA1589   
Map version
85 (location: 43827)
Chromosome
12
Position
51.60 cM
Confidence
uncalculated
Protocol
INDEL


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43578)
Chromosome
12
Position
57.10 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43287)
Chromosome
12
Position
53.40 cM
Confidence
uncalculated
Protocol
INDEL


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40828)
Chromosome
12
Position
55.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39895)
Chromosome
12
Position
66.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8472)
Chromosome
12
Position
47.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8475)
Chromosome
12
Position
57.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG111 was used as an overgo probe on plate 16 [well G10]

Plausible BAC Matches:   P136L06

 Overgo Sequences

A sequence
CCTCAGTAAGCTACAGCCTACAAG
B sequence
TAGACAGGACATGACACTTGTAGG
AB sequence
CCTCAGTAAGCTACAGCCTACAAGTGTCAT
Marker sequence
GGGGGGGGGGTTCGATACACCCTTAGCTCAAGTAAAGCATTGTAAAATCA
AGTAGGAAATGAAATATATTGAAGCAACAGCTGGGCATACATCACCAAAA
CAAATTGCCAACCCGGACAAAGAATTGTGGTAATTTGGTTTTAATACGGT
ATTCAGGAGTAAAATTTCTGAATACGGTATTCGGTACAATATACTAATAC
CATTCGATATTCACTAGGATTCTTTTGCCCACCATTTCTTCCTAGAACAC
TGAACAATCACAATAGAATGGTCGGACAAGCACCATCTAATCTGAGCCTG
ACTATCTCAAATCTCTAGTTTCAGATTCAATACTCTTTTATGATTTGTTT
TCTTCCCTTTTAATCTTCTTGTATAGAACTAATTTAGTTGTGGAAGAATC
AAACCTTCTACCCTGATCCTCGACCTATATATTCCTATCTAGGGTCATAT
CCTCAGTAAGCTACAGCCTACAAGTGTCATGTCCTGTCTAATCACTTCCC
CAATACTTCTTCGCATTTGGTGG
Genomic location of TG111  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D182 marker 182
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)