SGN Marker solcap_snp_sl_100670

SGN-M18211

Synonyms  
Le005019_205
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54542)
Chromosome
2
Position
32.53 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATTGAGGTGCTTTCTAGTTTCCATCAGTTTCTTGACCAATTCATAGTATG
  
3' flanking region
GGCATGTTAAATGGATTTAAGTGGAGAAGCTCCTCATTAGAATGTCTATT
SNP nucleotide
TC
SNPdb format
ATTGAGGTGCTTTCTAGTTTCCATCAGTTTCTTGACCAATTCATAGTATG[T/C]
GGCATGTTAAATGGATTTAAGTGGAGAAGCTCCTCATTAGAATGTCTATT
  
Genomic location of solcap_snp_sl_100670  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18211 marker 18211
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)