SGN Marker solcap_snp_sl_100689

SGN-M18230

Synonyms  
Le012888_154
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54561)
Chromosome
3
Position
57.05 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGATAAAGGCAACGAGGTCTTCAGAACTCTGAACTTGAGATCTAACAGAA
  
3' flanking region
TAGTACACTGCAATAAT
SNP nucleotide
TC
SNPdb format
TGATAAAGGCAACGAGGTCTTCAGAACTCTGAACTTGAGATCTAACAGAA[T/C]
TAGTACACTGCAATAAT
  
Genomic location of solcap_snp_sl_100689  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18230 marker 18230
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)