SGN Marker solcap_snp_sl_100700

SGN-M18241

Synonyms  
Le021823_29
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54572)
Chromosome
7
Position
57.24 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GGGGAGTGTTCAATGTATCGATAGTAGC
  
3' flanking region
TCTTTTGGCTCTATGCATGGGTGCTCCCATCTTAAACACGTGTTACTATA
SNP nucleotide
TG
SNPdb format
GGGGAGTGTTCAATGTATCGATAGTAGC[T/G]
TCTTTTGGCTCTATGCATGGGTGCTCCCATCTTAAACACGTGTTACTATA
  
Genomic location of solcap_snp_sl_100700  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18241 marker 18241
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)