SGN Marker solcap_snp_sl_100702

SGN-M18243

Synonyms  
Ohase1_Promoter_SNP2
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70341)
Chromosome
6
Position
7.69 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54574)
Chromosome
6
Position
22.43 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AAAAAAGGAAAAAATAGTAAGTGGGGCAACAATAGTGTAATTTTTATGAA
  
3' flanking region
GTTAGGACGAAAAAAAGCCTATTCTCTCCCAATGGCTAAAATGTTTTAGC
SNP nucleotide
AG
SNPdb format
AAAAAAGGAAAAAATAGTAAGTGGGGCAACAATAGTGTAATTTTTATGAA[A/G]
GTTAGGACGAAAAAAAGCCTATTCTCTCCCAATGGCTAAAATGTTTTAGC
  
Genomic location of solcap_snp_sl_100702  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18243 marker 18243
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)