SGN Marker T1190

SGN-M1825
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.05
Tomato EST read: TPTAA40TH
Arabidopsis best BAC match: AB025638.1
Arabidopsis position: 5.1400000
Arabidopsis identities: 0.952
Best GenBank protein hit: CAC12826.1
Evalue: 5e-104
Identities: 0.983
Description: malate dehydrogenase [Nicotiana tabacum]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53505)
Chromosome
9
Position
66.63 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-EXPIMP 2009

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39539)
Chromosome
9
Position
77.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 13972
Forward primer (5'-3')
GCGTTCTCGTTACTGGTGCT
Digested band sizes (using DraI)
Solanum pennellii LA716: 1800
Solanum lycopersicum LA925: 700+1100
Mg+2 concentration
Unknown
Reverse primer (5'-3')
GTTGCATGGTTGACATCAGG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1800
Solanum pennellii LA716: 1800
Approximate temperature
55°C
  
PCR data   Exp. ID 13972
Forward primer (5'-3')
GCGTTCTCGTTACTGGTGCT
Digested band sizes (using DraI)
Solanum pennellii LA716: 1800
Solanum lycopersicum LA925: 700+1100
Mg+2 concentration
Unknown
Reverse primer (5'-3')
GTTGCATGGTTGACATCAGG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1800
Solanum lycopersicum LA925: 1800
Approximate temperature
55°C
  
PCR data   Exp. ID 14138
Forward primer (5'-3')
GCGTTCTCGTTACTGGTGCT
Digested band sizes (using RsaI)
Solanum pimpinellifolium LA1589: 500+700+900
Solanum lycopersicum LA925: 400+600+700+1300
Mg+2 concentration
Unknown
Reverse primer (5'-3')
GTTGCATGGTTGACATCAGG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 2300
Solanum pimpinellifolium LA1589: 2300
Approximate temperature
55°C
  
PCR data   Exp. ID 118
Forward primer (5'-3')
Unknown
Digested band sizes (using DraI)
Solanum pennellii LA716: 1800
Solanum lycopersicum LA925: 700+1100
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1800
Solanum lycopersicum LA925: 1800
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
T1190 was used as an overgo probe on plate 15 [well C8]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ATCCAGTTCGCGTTCTCGTTACTG
B sequence
ATTTGTCCTGCAGCACCAGTAACG
AB sequence
ATCCAGTTCGCGTTCTCGTTACTGGTGCTG
Marker sequence
GTCATCGCTCTCGTTAACTTCTAGATCTTCAAGAAAAATGGCCAAAGATC
CAGTTCGCGTTCTCGTTACTGGTGCTGCAGGACAAATTGGATATGCCTTG
GTGCCTATGATTGCCAGGGGAGTGATGTTGGGCGCAGATCAGCCTGTAAT
TCTCCACATGTTGGATATTCCACCTGCTGCTGAGGCACTGAATGGAGTGA
AGATGGAATTAGTGGATGCTGCCTTCCCTCTTCTTAAGGGTGTCGTTGCC
ACAACTGATGCTGTTGAGGCATGCACCGGTGTCAACGTTGCGGTCATGGT
TGGAGGTTTCCCCAGGAAAGAAGGCATGGAAAGGAAAGATGTGATGTCAA
AGAATGTGTCTATTTACAAGTCCCAGGCATCTGCACTTGAGAAGCATGCA
GCTCCCAACTGCAAGGTGTTGGTTGTTGCTAACCCTGCCAATACAAATGC
ATTGATCTTGAAAGAATTTGCACCATCCATTCCTGAGAAGAATATTACCT
GTCTCACAAGGTTGGACCATAACAGGGCCCTCGGCCAAATCTCAGAGAGA
CTGAGTGTCCAAGTTAGTGATGTTAAAAATGTCAATTATTTGGGGAAACC
ACTCATCATCACAGTATCCTGATGTCAACCATGCAACAGTTTCAACACC
Genomic location of T1190  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1825 marker 1825
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)