Notice: The SGN server upgrade is complete. Please let us know if you find any issues. :-)

SGN Marker solcap_snp_sl_100720

SGN-M18261

Synonyms  
SGN-U145504_cLET-3-C15_snp216
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70343)
Chromosome
9
Position
0.82 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66880)
Chromosome
9
Position
26.62 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63365)
Chromosome
9
Position
38.12 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54592)
Chromosome
9
Position
2.84 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CATGATTTATTTTACAGAATGTCATCTCATGTAGTTTTGTCACAAATTGC
  
3' flanking region
AAGTCAAAAANCTGCTGTACTTTTTAAACATTTGAAATTGACCTGGTATC
SNP nucleotide
TC
SNPdb format
CATGATTTATTTTACAGAATGTCATCTCATGTAGTTTTGTCACAAATTGC[T/C]
AAGTCAAAAANCTGCTGTACTTTTTAAACATTTGAAATTGACCTGGTATC
  
Genomic location of solcap_snp_sl_100720  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18261 marker 18261
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)