SGN Marker solcap_snp_sl_100726

SGN-M18267

Synonyms  
SGN-U312789_snp112
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70348)
Chromosome
5
Position
48.95 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54598)
Chromosome
5
Position
59.25 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTTGGTGAGAAACATGATNGAATAGAGTTACTTGATATGTTTTACTGGTG
  
3' flanking region
GGAGGTGCACACAAGCTGGTCCAAACACTACGGTTATTAGAAAAACAAAA
SNP nucleotide
TC
SNPdb format
TTTGGTGAGAAACATGATNGAATAGAGTTACTTGATATGTTTTACTGGTG[T/C]
GGAGGTGCACACAAGCTGGTCCAAACACTACGGTTATTAGAAAAACAAAA
  
Genomic location of solcap_snp_sl_100726  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18267 marker 18267
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)