SGN Marker solcap_snp_sl_100727

SGN-M18268

Synonyms  
SGN-U313245_T0562_snp547
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70349)
Chromosome
2
Position
44.51 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66884)
Chromosome
2
Position
64.18 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54599)
Chromosome
2
Position
39.33 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CCCACTGCTAAAGATGCTCAGGCCATTGCTGATGATGTTTTCTCATTTTT
  
3' flanking region
GTGAGTGAAGAGGTTGACAAGGTTGAGCTTCTCTACACAAAGTTTGTGTC
SNP nucleotide
TC
SNPdb format
CCCACTGCTAAAGATGCTCAGGCCATTGCTGATGATGTTTTCTCATTTTT[T/C]
GTGAGTGAAGAGGTTGACAAGGTTGAGCTTCTCTACACAAAGTTTGTGTC
  
Genomic location of solcap_snp_sl_100727  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18268 marker 18268
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)