SGN Marker T1198

SGN-M1827
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAA63TV
Arabidopsis best BAC match: AC009853.2
Arabidopsis position: 3.0110000
Arabidopsis identities: 0.906
Best GenBank protein hit: AAF02160.1
Evalue: 1.2e-38
Identities: 0.720
Description: unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49403)
Chromosome
6
Position
1.68 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47337)
Chromosome
6
Position
4.11 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39540)
Chromosome
6
Position
5.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1198 was used as an overgo probe on plate 2 [well B4]

Plausible BAC Matches:   P020E07,   P126I02,   P313B19,   P089I06,   P191N08,   P251G05,   P042M18

 Overgo Sequences

A sequence
GGTGGAGGAATGTACAATAGTGGG
B sequence
CCATTGAGCCACCATACCCACTAT
AB sequence
GGTGGAGGAATGTACAATAGTGGGTATGGT
Marker sequence
TACAGAGGAAGTTATGGTGGACTTGCAAGCGGTGGCATGTATGGTGGAGG
AATGTACAATAGTGGGTATGGTGGCTCAATGGGAGGTTATGGCATGGGTG
GTATGGGTGGTATGGGCGGCATGGGTATGGGACCCTATGGGGACCAAGAT
CCAAATAATCCATATGGTGCTCCACCTTCTCCACCAGGCTTCTGGGTCTC
CTTCATGCATGTGATGCAAGGTGTTGTAACTTTTTTTGGCCGCGTTGCAA
TGTTGATAGACCAAAATACCCAGGCATTTCACATGTTCATGTCAGCGCTC
CTTCAGCTGTTTGATCGCTCAAGGTTATTATATGGAGAGCTGGCAAGATT
TGTGCTGAGACTGCTGGGGGTCAAAACAAAGCCTAAAATTCAGCCCCCAG
GTGCTAATGCACTTCCTGGTCCGCACCAACCTCGTGGTAATCAGACCTTT
ATCGAGGGACCCAAAGCTGCTCCAGGTGCTGCATGGAACGATGTGTGGGG
TGATAATGCACAGTGATATAGAGTAGTGACTTACAAATGTCACCTACCAT
CGGAAGCCATCAACAAGAAGTTGCAGTTTGTATGAATGCTACAGTATAGA
TAAGAGCTATGCTGGTGTGGTGTACTCGCATGTAAAACCAATCTACCTAC
CCTGCTGGATTGACTTGCTGCATTTAAA
Genomic location of T1198  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1827 marker 1827
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)