SGN Marker solcap_snp_sl_100730

SGN-M18271

Synonyms  
SGN-U313785_cLEF-41-C3_snp208
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70351)
Chromosome
2
Position
37.11 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66886)
Chromosome
2
Position
55.62 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63370)
Chromosome
2
Position
76.47 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54602)
Chromosome
2
Position
37.51 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GAAGTCAGAATAATTATNGAATTAAATTTTCGANGTGAATTTGAATTAGC
  
3' flanking region
AAAGCAAGTGAAGGATACAATCGACTAGTGAAATGCCTACCAGAAGTGTT
SNP nucleotide
AG
SNPdb format
GAAGTCAGAATAATTATNGAATTAAATTTTCGANGTGAATTTGAATTAGC[A/G]
AAAGCAAGTGAAGGATACAATCGACTAGTGAAATGCCTACCAGAAGTGTT
  
Genomic location of solcap_snp_sl_100730  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18271 marker 18271
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)