SGN Marker solcap_snp_sl_100736

SGN-M18277

Synonyms  
SGN-U315352_snp103
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70355)
Chromosome
2
Position
45.61 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54608)
Chromosome
2
Position
39.81 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGTCGTTTAGATCACCCTCTTCCTCTTCCTTCTGTTCTCGGAAGCCCTTT
  
3' flanking region
AAAGTCGTTGATGGTCCTCCTTCATCTGCCGCCGGTCATCCAGGTCTTTT
SNP nucleotide
TC
SNPdb format
AGTCGTTTAGATCACCCTCTTCCTCTTCCTTCTGTTCTCGGAAGCCCTTT[T/C]
AAAGTCGTTGATGGTCCTCCTTCATCTGCCGCCGGTCATCCAGGTCTTTT
  
Genomic location of solcap_snp_sl_100736  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18277 marker 18277
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)