SGN Marker solcap_snp_sl_100737

SGN-M18278

Synonyms  
SGN-U315700_C2_At2g47590_snp377
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70356)
Chromosome
9
Position
38.69 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66889)
Chromosome
9
Position
53.44 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63373)
Chromosome
9
Position
74.17 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54609)
Chromosome
9
Position
62.46 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGTATTGGATGAAAGTAGTTTTACCTTTGATGTCAAAGANCTTGTAATTT
  
3' flanking region
ACTGAAATGACATATTTGCGAGTGTTGGAATGAAACTGGTGTAAATGTAG
SNP nucleotide
AG
SNPdb format
AGTATTGGATGAAAGTAGTTTTACCTTTGATGTCAAAGANCTTGTAATTT[A/G]
ACTGAAATGACATATTTGCGAGTGTTGGAATGAAACTGGTGTAAATGTAG
  
Genomic location of solcap_snp_sl_100737  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18278 marker 18278
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)