SGN Marker solcap_snp_sl_100738

SGN-M18279

Synonyms  
SGN-U315881_T1698_snp147
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70357)
Chromosome
2
Position
21.22 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66890)
Chromosome
2
Position
32.26 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63374)
Chromosome
2
Position
46.45 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54610)
Chromosome
2
Position
33.36 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TATTCTGGGAAATACACTGTTCCGGTATTGTTTATCAATAAATAGAATCT
  
3' flanking region
TAATAACATTTATTTGCTTGGTCTGTTCATATTTTTATTGATTGATGGTC
SNP nucleotide
TC
SNPdb format
TATTCTGGGAAATACACTGTTCCGGTATTGTTTATCAATAAATAGAATCT[T/C]
TAATAACATTTATTTGCTTGGTCTGTTCATATTTTTATTGATTGATGGTC
  
Genomic location of solcap_snp_sl_100738  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18279 marker 18279
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)