SGN Marker solcap_snp_sl_100739

SGN-M18280

Synonyms  
SGN-U315914_C2_At5g67370_snp371
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66891)
Chromosome
2
Position
103.56 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63375)
Chromosome
2
Position
145.62 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54611)
Chromosome
2
Position
48.27 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TAATAGGGATAGGAGCTCCGCTGGAGATAGATAATTTGAGAACTTAACTT
  
3' flanking region
TCTAATATTCTACGTAACATTCTAATTCCTGACAATNACCANAATAGGGA
SNP nucleotide
TC
SNPdb format
TAATAGGGATAGGAGCTCCGCTGGAGATAGATAATTTGAGAACTTAACTT[T/C]
TCTAATATTCTACGTAACATTCTAATTCCTGACAATNACCANAATAGGGA
  
Genomic location of solcap_snp_sl_100739  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18280 marker 18280
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)