SGN Marker solcap_snp_sl_100741

SGN-M18282

Synonyms  
SGN-U316416_snp254
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54613)
Chromosome
3
Position
38.80 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGAAAATTTGGAGTCACCACCTAATGGAACAGATCGTATTGTTAAGTGTG
  
3' flanking region
AAGTCACTTGACCAATCCCTTGAAATTTTTTTCAAAACTTGAAGTTGATC
SNP nucleotide
AC
SNPdb format
TGAAAATTTGGAGTCACCACCTAATGGAACAGATCGTATTGTTAAGTGTG[A/C]
AAGTCACTTGACCAATCCCTTGAAATTTTTTTCAAAACTTGAAGTTGATC
  
Genomic location of solcap_snp_sl_100741  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18282 marker 18282
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)