SGN Marker solcap_snp_sl_100753

SGN-M18294

Synonyms  
SGN-U330351_C2_At2g37500_snp549
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70368)
Chromosome
9
Position
0.82 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66901)
Chromosome
9
Position
33.57 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63385)
Chromosome
9
Position
44.90 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54625)
Chromosome
9
Position
3.79 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTGTAGTTCTGTACTCTGCATACTGTTTGCTTGTCCTATATTGACTTAAG
  
3' flanking region
AATGACGTGATACAAAAAGAAGAAAAGTCGTTCTAATTGGTTACTATTGA
SNP nucleotide
AC
SNPdb format
TTGTAGTTCTGTACTCTGCATACTGTTTGCTTGTCCTATATTGACTTAAG[A/C]
AATGACGTGATACAAAAAGAAGAAAAGTCGTTCTAATTGGTTACTATTGA
  
Genomic location of solcap_snp_sl_100753  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18294 marker 18294
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)