SGN Marker solcap_snp_sl_100760

SGN-M18301

Synonyms  
SGN-U563755_snp20986
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66906)
Chromosome
8
Position
69.29 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63388)
Chromosome
8
Position
106.00 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54632)
Chromosome
8
Position
61.55 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGGTATTTCAATGATAAAATCTATTTCCATGTACTTTTTACGGAGGATGG
  
3' flanking region
AGGATGGAGCGCTCCACTTTTCTTGAGGTAACATACATTGTTGAATTTTT
SNP nucleotide
AG
SNPdb format
TGGTATTTCAATGATAAAATCTATTTCCATGTACTTTTTACGGAGGATGG[A/G]
AGGATGGAGCGCTCCACTTTTCTTGAGGTAACATACATTGTTGAATTTTT
  
Genomic location of solcap_snp_sl_100760  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18301 marker 18301
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)