SGN Marker solcap_snp_sl_100763

SGN-M18304

Synonyms  
SGN-U564980_snp30641
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70379)
Chromosome
11
Position
61.02 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66911)
Chromosome
11
Position
61.40 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63393)
Chromosome
11
Position
73.84 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54635)
Chromosome
11
Position
49.51 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TACTCGCCACTAGCATATACTGTGTTCAAAGCCAGCAACATGCACAATGA
  
3' flanking region
ATTTCACACGTAAGGCATGAAGAGGGTGGTTTACATAGCCTCAAACAAAG
SNP nucleotide
AC
SNPdb format
TACTCGCCACTAGCATATACTGTGTTCAAAGCCAGCAACATGCACAATGA[A/C]
ATTTCACACGTAAGGCATGAAGAGGGTGGTTTACATAGCCTCAAACAAAG
  
Genomic location of solcap_snp_sl_100763  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18304 marker 18304
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)