Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker solcap_snp_sl_100774

SGN-M18315

Synonyms  
SGN-U566039_snp997
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70386)
Chromosome
5
Position
15.66 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66917)
Chromosome
5
Position
19.69 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63399)
Chromosome
5
Position
23.82 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54646)
Chromosome
5
Position
2.23 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATCAACAACCACTTTTTGTGAATCCAACATTTCAATCTCAGTGATGATCA
  
3' flanking region
TAGCGGAGACAGAATTTTCATCAAGAATCTTCTAAATAGATTCTCAGTTA
SNP nucleotide
AG
SNPdb format
ATCAACAACCACTTTTTGTGAATCCAACATTTCAATCTCAGTGATGATCA[A/G]
TAGCGGAGACAGAATTTTCATCAAGAATCTTCTAAATAGATTCTCAGTTA
  
Genomic location of solcap_snp_sl_100774  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18315 marker 18315
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)