SGN Marker solcap_snp_sl_100779

SGN-M18320

Synonyms  
SGN-U567576_snp414
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70393)
Chromosome
6
Position
65.13 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54651)
Chromosome
6
Position
44.72 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCTGTTTGAATAGGAAATAAGTCATGCTTTGGAACTGCTACCATCATTTT
  
3' flanking region
AGGAATTTTACTTTTATGGTTAATTAAATGCAACTAGTTGTTTTATGGTC
SNP nucleotide
AG
SNPdb format
TCTGTTTGAATAGGAAATAAGTCATGCTTTGGAACTGCTACCATCATTTT[A/G]
AGGAATTTTACTTTTATGGTTAATTAAATGCAACTAGTTGTTTTATGGTC
  
Genomic location of solcap_snp_sl_100779  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18320 marker 18320
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)