SGN Marker solcap_snp_sl_100782

SGN-M18323

Synonyms  
SGN-U568700_snp42664
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66926)
Chromosome
2
Position
76.80 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63408)
Chromosome
2
Position
107.68 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54654)
Chromosome
2
Position
42.72 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AATTACTATTCTTTGATCACAAAATTTAAACCTTATGTGGTAAGTACTCA
  
3' flanking region
TAGTAGCACCAATTAATTCTATCACAAAAGTCTCTTTAAATTCCCTATTC
SNP nucleotide
TC
SNPdb format
AATTACTATTCTTTGATCACAAAATTTAAACCTTATGTGGTAAGTACTCA[T/C]
TAGTAGCACCAATTAATTCTATCACAAAAGTCTCTTTAAATTCCCTATTC
  
Genomic location of solcap_snp_sl_100782  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18323 marker 18323
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)