SGN Marker T1205

SGN-M1833
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAA76TV
Arabidopsis best BAC match: AC006283.5
Arabidopsis position: 2.1610000
Arabidopsis identities: 0.701
Best GenBank protein hit: AAD20681.1
Evalue: 6.0e-44
Identities: 0.594
Description: putative RNA methyltransferase [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39545)
Chromosome
11
Position
77.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1205 was used as an overgo probe on plate 10 [well C9]

Plausible BAC Matches:   P269K19,   P161D01

 Overgo Sequences

A sequence
CCTTTTCCGATTCGTCTGGAGAAG
B sequence
ATTGAGCTCTGCACACCTTCTCCA
AB sequence
CCTTTTCCGATTCGTCTGGAGAAGGTGTGC
Marker sequence
CCGAACAGGGAATCAGGAAACTGGAAATTGGTAATAAAATAAGGAAAAAG
TTACAAAACAAAATTATGGAAATCTTCCACGAGTAAAAGATTGACTCAAA
ACTGCCATCAGTAACAGATATCAAGTAACTGTTTGTCGAAAGCGCATCCC
TTGTTTTCCACATTGAGAGAACAAATCTAAAGGAACATTTCTATTTCCTC
ACATAAATATGGCTACTCAAGATTATCACTTAAGGAAATAGATAAATTTA
CCTCTCCAGAAGCATCACCAGTTCACAATGAGGAGAATGTGGAAAAAGAT
CAACAGCCATGGCTTTGACAGGTTTAAAAGGCTCTGAATTGGGCATAGAT
TTGGTCCTATGTCGTGCAAGAGTAGCGCTGCTCATCTTCCTCCATAATCT
GTTGTTCCTATTATCCCCCTTTTCCGATTCGTCTGGAGAAGGTGTGCAGA
GCTCAATAGCGTTTGCAACCAAGCTTTCAGGATTACAGGAAATGTAAACA
AGCCTCCTTAGACGTGAGTTAGTCCTTAAAAGTTTGATAACAGTGGGATG
AAGTCCAGCACGTGGAGGATCTACAATTGCAACAACATTCTTGAAATGTT
GCACTGGAGTGGTCAAATTATCTGATGAACACTTCTTAAGTTGGGTTGCT
GGTTCTGTAGTGCCATCTGCTGAAGAATCTGACAAGCTTTTACCATTGGT
ACACTCAA
Genomic location of T1205  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1833 marker 1833
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)