SGN Marker solcap_snp_sl_100791

SGN-M18332

Synonyms  
SGN-U570510_snp15996
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54663)
Chromosome
8
Position
51.43 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTAGGTGAAAAAATCCAAGGGGAAGAAGAGGCACAATTTTCTACAGTGCC
  
3' flanking region
ATCCATGTTGTCACTAATCCATCTGAACTACCTGTTGAATTCTTGGAACC
SNP nucleotide
AG
SNPdb format
CTAGGTGAAAAAATCCAAGGGGAAGAAGAGGCACAATTTTCTACAGTGCC[A/G]
ATCCATGTTGTCACTAATCCATCTGAACTACCTGTTGAATTCTTGGAACC
  
Genomic location of solcap_snp_sl_100791  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18332 marker 18332
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)