SGN Marker solcap_snp_sl_100794

SGN-M18335

Synonyms  
SGN-U571023_snp534
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66933)
Chromosome
2
Position
75.22 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63415)
Chromosome
2
Position
107.00 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54666)
Chromosome
2
Position
42.42 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CACGGACTGATCGGAAGCTTCTTAAAATCGCCACAACTCAAGGCTCGTAT
  
3' flanking region
ACACGGGACATTGAAGCCTCTGTCCGCCATTTCTTGTCAACATGGCTCGA
SNP nucleotide
TC
SNPdb format
CACGGACTGATCGGAAGCTTCTTAAAATCGCCACAACTCAAGGCTCGTAT[T/C]
ACACGGGACATTGAAGCCTCTGTCCGCCATTTCTTGTCAACATGGCTCGA
  
Genomic location of solcap_snp_sl_100794  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18335 marker 18335
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)