SGN Marker solcap_snp_sl_100795

SGN-M18336

Synonyms  
SGN-U571208_snp268
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70403)
Chromosome
2
Position
11.29 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66934)
Chromosome
2
Position
21.85 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63416)
Chromosome
2
Position
25.94 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54667)
Chromosome
2
Position
31.50 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGGGGACAAGAAGCCTGGCCAACGCCCATGTACTGAATACAATAACTGCA
  
3' flanking region
GCGTTCTCCAGATTAAGTGATTTTTCAATCTATAAATACGTTTATCATTT
SNP nucleotide
AG
SNPdb format
AGGGGACAAGAAGCCTGGCCAACGCCCATGTACTGAATACAATAACTGCA[A/G]
GCGTTCTCCAGATTAAGTGATTTTTCAATCTATAAATACGTTTATCATTT
  
Genomic location of solcap_snp_sl_100795  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18336 marker 18336
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)