SGN Marker solcap_snp_sl_100797

SGN-M18338

Synonyms  
SGN-U571949_snp12652
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54669)
Chromosome
8
Position
51.42 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCTCCTTCTGAGGGACTTGTATACAAGCCATTTCCTGGACCTGGATTCAC
  
3' flanking region
AGTCCTATTTGTGGAAGTGGGCCTCCAGGATCGAGTCCAACAATGGGGAA
SNP nucleotide
AG
SNPdb format
TCTCCTTCTGAGGGACTTGTATACAAGCCATTTCCTGGACCTGGATTCAC[A/G]
AGTCCTATTTGTGGAAGTGGGCCTCCAGGATCGAGTCCAACAATGGGGAA
  
Genomic location of solcap_snp_sl_100797  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18338 marker 18338
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)