SGN Marker solcap_snp_sl_100810

SGN-M18351

Synonyms  
SGN-U574631_snp51901
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70417)
Chromosome
9
Position
72.12 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66946)
Chromosome
9
Position
93.16 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63425)
Chromosome
9
Position
132.51 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54682)
Chromosome
9
Position
67.27 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CAATACAGATATGGGAGAAAACTAAAGATCTGAAGGCACAAGTGGAGACG
  
3' flanking region
ACTATAAATCCTTAAAATTCACTCCATCGCAATTCCCCACTGTTGGTGGA
SNP nucleotide
TC
SNPdb format
CAATACAGATATGGGAGAAAACTAAAGATCTGAAGGCACAAGTGGAGACG[T/C]
ACTATAAATCCTTAAAATTCACTCCATCGCAATTCCCCACTGTTGGTGGA
  
Genomic location of solcap_snp_sl_100810  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18351 marker 18351
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)