SGN Marker solcap_snp_sl_100814

SGN-M18355

Synonyms  
SGN-U575324_snp56571
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70422)
Chromosome
2
Position
45.88 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66949)
Chromosome
2
Position
66.38 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63428)
Chromosome
2
Position
96.16 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54686)
Chromosome
2
Position
40.02 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCAACCAAAACATTGTGGCTATGATCCTGGCTTTGAACTACACTGTAACA
  
3' flanking region
TAAAGGTGACACCATCCTTGAGCTTCCCTCCTCTGTTCACTTTGGTGTTG
SNP nucleotide
AC
SNPdb format
TCAACCAAAACATTGTGGCTATGATCCTGGCTTTGAACTACACTGTAACA[A/C]
TAAAGGTGACACCATCCTTGAGCTTCCCTCCTCTGTTCACTTTGGTGTTG
  
Genomic location of solcap_snp_sl_100814  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18355 marker 18355
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)