SGN Marker solcap_snp_sl_100816

SGN-M18357

Synonyms  
SGN-U575324_snp57048
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70423)
Chromosome
2
Position
45.88 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66950)
Chromosome
2
Position
66.38 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63429)
Chromosome
2
Position
96.16 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54688)
Chromosome
2
Position
40.02 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CGGAACAAAGCTATTGGAAACTCATTGTTTCAATCGAAAAGATATAACCC
  
3' flanking region
AACAGGTACTACTTGCATATCTTAATTAATTTTTTCCATCATTATTTAAA
SNP nucleotide
AG
SNPdb format
CGGAACAAAGCTATTGGAAACTCATTGTTTCAATCGAAAAGATATAACCC[A/G]
AACAGGTACTACTTGCATATCTTAATTAATTTTTTCCATCATTATTTAAA
  
Genomic location of solcap_snp_sl_100816  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18357 marker 18357
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)