Notice: The SGN server upgrade is complete. Please let us know if you find any issues. :-)

SGN Marker solcap_snp_sl_100817

SGN-M18358

Synonyms  
SGN-U575324_snp58160
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54689)
Chromosome
2
Position
40.02 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTTGGAGAAAGGGGAAGAATTAAAGATTCAGATAGAGGAAGAAGGAGATG
  
3' flanking region
TAGAATTGTGAGAAAGTTAGCTATTGTTGGACTTTGGTGCATACAGTGGC
SNP nucleotide
CG
SNPdb format
TTTGGAGAAAGGGGAAGAATTAAAGATTCAGATAGAGGAAGAAGGAGATG[C/G]
TAGAATTGTGAGAAAGTTAGCTATTGTTGGACTTTGGTGCATACAGTGGC
  
Genomic location of solcap_snp_sl_100817  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18358 marker 18358
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)