SGN Marker solcap_snp_sl_100818

SGN-M18359

Synonyms  
SGN-U575324_snp58163
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54690)
Chromosome
2
Position
40.02 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GGAGAAAGGGGAAGAATTAAAGATTCAGATAGAGGAAGAAGGAGATGGTA
  
3' flanking region
AATTGTGAGAAAGTTAGCTATTGTTGGACTTTGGTGCATACAGTGGCATC
SNP nucleotide
CG
SNPdb format
GGAGAAAGGGGAAGAATTAAAGATTCAGATAGAGGAAGAAGGAGATGGTA[C/G]
AATTGTGAGAAAGTTAGCTATTGTTGGACTTTGGTGCATACAGTGGCATC
  
Genomic location of solcap_snp_sl_100818  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18359 marker 18359
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)