SGN Marker solcap_snp_sl_100821

SGN-M18362

Synonyms  
SGN-U575424_snp27024
SGN-U575424_snp27024_SGN-U575424_snp51036
SGN-U575424_snp51036
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70424)
Chromosome
9
Position
72.12 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54693)
Chromosome
9
Position
67.28 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTGTTGGAATTCTTTGAAGGTAAAATCAGTTTAAGTTACAACCATGAGTT
  
3' flanking region
AATGATTCTGATCTGTCGAAATATATGGATTGTGTTGGAAAGAATCTAAA
SNP nucleotide
CG
SNPdb format
TTGTTGGAATTCTTTGAAGGTAAAATCAGTTTAAGTTACAACCATGAGTT[C/G]
AATGATTCTGATCTGTCGAAATATATGGATTGTGTTGGAAAGAATCTAAA
  
Genomic location of solcap_snp_sl_100821  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18362 marker 18362
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)