SGN Marker T1211

SGN-M1837
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.01.10
Tomato EST read: TPTAA86TV
Arabidopsis best BAC match: AB018115.1
Arabidopsis position: 5.2160000
Arabidopsis identities: 0.652
Best GenBank protein hit: AAF73132.1
Evalue: 2.6e-65
Identities: 0.990
Description: "homogentisate 1,2-dioxygenase [Lycopersicon esculentum]"
Comment: catabolism of phenylalanine and tyrosine
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39547)
Chromosome
12
Position
53.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1211 was used as an overgo probe on plate 5 [well C1]

Plausible BAC Matches:   P033L11,   P336J04,   P208O14,   P173E06,   P160M23,   P077M10,   P206N09,   P041I22,   P092C16,   P021L02

 Overgo Sequences

A sequence
GTGGACCAGCTTCATTTCCAAGTG
B sequence
TTTGAGGCGACCATTGCACTTGGA
AB sequence
GTGGACCAGCTTCATTTCCAAGTGCAATGG
Marker sequence
AATATCAAACATTGCCATAAATCATTACTTAATTCATTGCTCTTGTAATT
GCAACAAGTATTTCCATGATAGTTCCATCTTTATATATATACAAAATGCA
CCATAAACTACAAGTCTACATGCAACATCATCACGGTAACACATTTTTAC
TTACGTCGCAATTTCATAGAACATTGGTTTCATCTTACCACTACATCCGC
GCTTGGATCGTCACCCTAAACTTTCAATCTGATACTAACATAGGGTTTAT
TCTATGTTTTACATGCCCGTGACTCGTTATGTACAAGCTAAGTCACTTTA
GGAGGAACTACAGGAGCTAGCTGAACAATGAGCATTTCACCTTTCTATGG
GTTTTCCTTTCTGCAAATCGACATTGTCTTCGTTCATAGATAGTCCTGAG
AAGTGAGACTTCAAGCCAATCCAGCATTGATAATAATCGTGATCCATAAA
CGGAGATTCAAGTGCCCACGGACAGACTCGGGGTATTAGGCAAGACTCAA
ACATGAAAGCCATGGTATCAGCTATTCTATGTGGACCAGCTTCATTTCCA
AGTGCAATGGTCGCCTCAAATGTTTTGGTATCAGGACCATGAGGAGTCAT
GCAGCTGTGAAGGCTTGCCCCGCCAGGGTGAAAACCATCAGCTTTTGCCT
CGTATCCCCCATAGATAA
Genomic location of T1211  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1837 marker 1837
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)