SGN Marker solcap_snp_sl_100830

SGN-M18371

Synonyms  
SGN-U575806_snp19756
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54702)
Chromosome
12
Position
0.24 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATGTAGTAGTCTCTTCGTTTCAATTTATGTGAATTCGTGGACACCGAGTT
  
3' flanking region
AAGAAAGAAAAGAAGATTTTGATCTACAGTCTGTAGATTTTGAGGTCATG
SNP nucleotide
AT
SNPdb format
ATGTAGTAGTCTCTTCGTTTCAATTTATGTGAATTCGTGGACACCGAGTT[A/T]
AAGAAAGAAAAGAAGATTTTGATCTACAGTCTGTAGATTTTGAGGTCATG
  
Genomic location of solcap_snp_sl_100830  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18371 marker 18371
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)