SGN Marker solcap_snp_sl_100831

SGN-M18372

Synonyms  
SGN-U575873_snp121
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70426)
Chromosome
2
Position
37.11 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54703)
Chromosome
2
Position
37.51 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTCGGAGTTATGGCTCGGAAACCTCTAAATCACCGGATTTTGACGTGGGA
  
3' flanking region
CACCGGGAAATTGAGATTTCCGGTGAGCCTACTATAAACAATTCCGATAC
SNP nucleotide
CG
SNPdb format
GTCGGAGTTATGGCTCGGAAACCTCTAAATCACCGGATTTTGACGTGGGA[C/G]
CACCGGGAAATTGAGATTTCCGGTGAGCCTACTATAAACAATTCCGATAC
  
Genomic location of solcap_snp_sl_100831  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18372 marker 18372
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)