SGN Marker solcap_snp_sl_100835

SGN-M18376

Synonyms  
SGN-U576591_snp67938
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70433)
Chromosome
2
Position
51.10 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66958)
Chromosome
2
Position
71.44 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63435)
Chromosome
2
Position
101.57 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54707)
Chromosome
2
Position
41.36 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTTGTTCTATTTATGAACTTTTGCTAAAGTAGCTGTAATAAGTTAGGAAC
  
3' flanking region
CTAGGAAGAAATCTTGTCTTCCCCTTGCACTTCACATTTTCTTTAGCGTT
SNP nucleotide
AT
SNPdb format
TTTGTTCTATTTATGAACTTTTGCTAAAGTAGCTGTAATAAGTTAGGAAC[A/T]
CTAGGAAGAAATCTTGTCTTCCCCTTGCACTTCACATTTTCTTTAGCGTT
  
Genomic location of solcap_snp_sl_100835  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18376 marker 18376
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)