Notice: The SGN server upgrade is complete. Please let us know if you find any issues. :-)

SGN Marker T1212

SGN-M1838
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 2.01
Tomato EST read: TPTAA89TH
Arabidopsis best BAC match: AL132957.1
Arabidopsis position: 3.1186000
Arabidopsis identities: 0.811
Best GenBank protein hit: AAD25541.1
Evalue: 7.8e-86
Identities: 0.961
Description: "fructose-1,6-bisphosphatase precursor [Solanum tuberosum]"
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49407)
Chromosome
9
Position
5.09 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47341)
Chromosome
9
Position
49.15 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39548)
Chromosome
9
Position
48.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1212 was used as an overgo probe on plate 15 [well D8]

Plausible BAC Matches:   P296G01,   P336G05,   P171I21,   P064P10,   P113O23,   P026P14,   P268K11

 Overgo Sequences

A sequence
GAGGAGTTAAGTGCATGGCAATAG
B sequence
ACACCTGAAGCTGTCTCTATTGCC
AB sequence
GAGGAGTTAAGTGCATGGCAATAGAGACAG
Marker sequence
GTGAACTTGTAAACTGTAGAAATTTTAGTGATTTCAAGAATCCCAAGAAA
ATCACAATGGCAGCATCAGCAGCCACAGCAACAGCAACAACTTCATATTT
AAGTGCTCTAGACAAAAAGACTCCATTTTTATTTGCCTTAGACAAAAAGA
CTCCATTTTTATGCTCAAAAAACAGCACAAAGAGAAGGTCATTTAATGGA
GGAGTTAAGTGCATGGCAATAGAGACAGCTTCAGGTGTTACACAAACCAA
GAAAAAGAGTGGCTATGAGTTACAAACTTTAACAAGTTGGCTATTGAGAC
AAGAACAAGCTGGAGTTATTGATGCTGAACTTACCATAGTAATTTCAAGT
ATCTCAATGGCTTGTAAACAGATTGCTTCTTTGGTCCAAAGAGCTGGAAT
TTCTAACCTTACTGGAGTTCAAGGTGCTGTCAATATTCAAGGAGAAGATC
AGAAGAAACTTGATGTTGTCTCTAATGAGGTTTTCTCGAATTGTCTAAGA
TCAAGTGGAAGGACTGGGATTATAGCATCAGAAGAAGAGGATGTACCTGT
GGCAGTGGAAGAGAGTTACTCAGGCAACTACATTGTGGTGGTTGATCCT
Genomic location of T1212  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1838 marker 1838
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)