SGN Marker solcap_snp_sl_100842

SGN-M18383

Synonyms  
SGN-U576696_snp63412
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66959)
Chromosome
2
Position
73.02 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63436)
Chromosome
2
Position
104.96 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54714)
Chromosome
2
Position
41.80 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTGCTTAAAAAGGTGAAGACTGCAAAACCTTATATCCAGTTTATGCAACT
  
3' flanking region
TGAGTGTCTCATTGATAAAATGCATATTTATCCTCAAATCTAATGGAAAA
SNP nucleotide
TC
SNPdb format
CTGCTTAAAAAGGTGAAGACTGCAAAACCTTATATCCAGTTTATGCAACT[T/C]
TGAGTGTCTCATTGATAAAATGCATATTTATCCTCAAATCTAATGGAAAA
  
Genomic location of solcap_snp_sl_100842  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18383 marker 18383
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)