SGN Marker TG118

SGN-M184

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2500
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
TGCTACATTTTGTTGAGGAAAATGTGTTATGATATGGAAGTAGATGTGTCAACCTTAAGAATGTTGGTTTTAGCTTTGGTAAATGTGGTT
TGGTGTCTATACAGAATTTCTTCTGCGCGACAGACACCTTGCTGGCACGAGGCATATAGAGTTTGGTGATAAGAATCAGAGTCCGAATTG
AAGAGGAAAGTATATTATTAGTTTTTAGTTAAGAGATGGATTGTTAAACTCTCGCATGGAAGCTTAGCAAAACTATAGTAGGTCCAAAGT
CTGAATAAGAGAGGAGGATCGTGGTAGATTGTCGACAAGCTTAGGATAATTTAATTACGATGAAGTTTATGAATACTTTCTATGGGGCTT
GCCTACATAGAATGTGTTCTTGAATAGATTCAAAAGGATTTATAAGTTGAAACAAAAGGATGTAAAAGACTCATATATCCGGAACCAACT
AGTTTGGGTTGACGTGTAGTTGATTGATTGATTGTTTCT
Reverse sequence
GAAAGAACATGGAAGGAGTTAAGAATATATTACATCTACAAGTAATACGGTGCATGCAACTGAATGAAGAAAAAACAATAAGATGTTGTA
TATATTAGTTCCAAATTAGTTTAACAAAGATGAATGTTATTAAAGAAGAAAGCTTATCATGGAACTTCAATTAGCCAAAGAAAATCAAAC
ATATGCCAGTGCTAACAGCTTTCCTTGACAGAATCCCCCCACTCCTTCAGGCCCCCATAGGTTAGAAAAAATTATAGATTGTAGAGACCA
TCAGTTGAAAAAATAAATTGGAAAGATGATTATTGACTGACATCAACAAGCTGAGAAATCTTGAAACAGCGTTAAATCATAAAGACAATC
CCAAAAACTCATATGTCCTTCAAGAAGCAATAAGGTAAGTACAAATGATACTTACATCTCAAATTCTATACTTTCCCCAATAGGAACACA
GCGAGCATGACACACAGGCGTTCCGCCCTTGGCAATAGTGCCATGCCATATATAATTATGCCCAGGAAG
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53163)
Chromosome
6
Position
27.02 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_6 MQTL_1_Maturity_6 MQTL_2_Late_blight_6 MQTL_2_Maturity_6
Potato meta-QTL consensus map

Map: Pepper-FAO3   
Map version
31 (location: 8479)
Chromosome
6
Position
29.56 cM
Confidence
uncalculated
Protocol
RFLP


Pepper-FAO3

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8478)
Chromosome
6
Position
22.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8480)
Chromosome
6
Position
14.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG118 was used as an overgo probe on plate 2 [well D8]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TAAGAGAGGAGGATCGTGGTAGAT
B sequence
CCTAAGCTTGTCGACAATCTACCA
AB sequence
TAAGAGAGGAGGATCGTGGTAGATTGTCGA
Marker sequence
TGCTACATTTTGTTGAGGAAAATGTGTTATGATATGGAAGTAGATGTGTC
AACCTTAAGAATGTTGGTTTTAGCTTTGGTAAATGTGGTTTGGTGTCTAT
ACAGAATTTCTTCTGCGCGACAGACACCTTGCTGGCACGAGGCATATAGA
GTTTGGTGATAAGAATCAGAGTCCGAATTGAAGAGGAAAGTATATTATTA
GTTTTTAGTTAAGAGATGGATTGTTAAACTCTCGCATGGAAGCTTAGCAA
AACTATAGTAGGTCCAAAGTCTGAATAAGAGAGGAGGATCGTGGTAGATT
GTCGACAAGCTTAGGATAATTTAATTACGATGAAGTTTATGAATACTTTC
TATGGGGCTTGCCTACATAGAATGTGTTCTTGAATAGATTCAAAAGGATT
TATAAGTTGAAACAAAAGGATGTAAAAGACTCATATATCCGGAACCAACT
AGTTTGGGTTGACGTGTAGTTGATTGATTGATTGTTTCT
Marker Submitted By 
Name: Molly Jahn
Organization: Cornell University
Genomic location of TG118  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D184 marker 184
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)