SGN Marker solcap_snp_sl_100885

SGN-M18426

Synonyms  
SGN-U579474_snp760
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70448)
Chromosome
7
Position
33.98 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54757)
Chromosome
7
Position
52.69 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AAGACTGCAGAGGAGAAGACTGTTGGTGGTATCCTACTTCCAGTATCAGT
  
3' flanking region
CAGTCGAAACCTAATGGAGGTGAGGTGGTTGCTGTTGGGGAGGGTCATTC
SNP nucleotide
TC
SNPdb format
AAGACTGCAGAGGAGAAGACTGTTGGTGGTATCCTACTTCCAGTATCAGT[T/C]
CAGTCGAAACCTAATGGAGGTGAGGTGGTTGCTGTTGGGGAGGGTCATTC
  
Genomic location of solcap_snp_sl_100885  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18426 marker 18426
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)