SGN Marker solcap_snp_sl_100890

SGN-M18431

Synonyms  
SGN-U580186_snp798
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70452)
Chromosome
8
Position
75.72 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66983)
Chromosome
8
Position
75.61 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63459)
Chromosome
8
Position
115.53 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54762)
Chromosome
8
Position
62.38 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGGTTGATATCTTTCAGGCTCGAAGAACTCGAACGTAGAGAGAAAGGACC
  
3' flanking region
CCAATGGTGAATCTTAAGTCTGTGATACTTGAGAAGATGGTAGAAAAGAG
SNP nucleotide
AG
SNPdb format
AGGTTGATATCTTTCAGGCTCGAAGAACTCGAACGTAGAGAGAAAGGACC[A/G]
CCAATGGTGAATCTTAAGTCTGTGATACTTGAGAAGATGGTAGAAAAGAG
  
Genomic location of solcap_snp_sl_100890  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18431 marker 18431
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)