SGN Marker solcap_snp_sl_100892

SGN-M18433

Synonyms  
SGN-U580658_snp1717
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54764)
Chromosome
1
Position
88.05 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTGTATGTGCTAGCTCAACTATGCTAAATAACATGTTCTTGTAGATGTAC
  
3' flanking region
ACTCAGTTTTTATAATATTATTATAAATATGCCGCTGTCCAGCTCTCAAA
SNP nucleotide
AG
SNPdb format
CTGTATGTGCTAGCTCAACTATGCTAAATAACATGTTCTTGTAGATGTAC[A/G]
ACTCAGTTTTTATAATATTATTATAAATATGCCGCTGTCCAGCTCTCAAA
  
Genomic location of solcap_snp_sl_100892  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18433 marker 18433
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)