Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker solcap_snp_sl_100896

SGN-M18437

Synonyms  
SGN-U581437_snp1661
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70464)
Chromosome
11
Position
26.29 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66994)
Chromosome
11
Position
28.28 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54768)
Chromosome
11
Position
3.67 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AAGTTTGTTTCCCCTGATGGAAGATAAAAAGAGCCTTGCTTCTTCTGAGG
  
3' flanking region
AAGAGCTCTTATCAAAGGAAAGGCTTCATTATTGGCTGCAGTTGATTATT
SNP nucleotide
AT
SNPdb format
AAGTTTGTTTCCCCTGATGGAAGATAAAAAGAGCCTTGCTTCTTCTGAGG[A/T]
AAGAGCTCTTATCAAAGGAAAGGCTTCATTATTGGCTGCAGTTGATTATT
  
Genomic location of solcap_snp_sl_100896  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18437 marker 18437
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)