SGN Marker solcap_snp_sl_100898

SGN-M18439

Synonyms  
SGN-U581552_snp1767
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70466)
Chromosome
11
Position
22.69 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66996)
Chromosome
11
Position
25.43 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54770)
Chromosome
11
Position
3.20 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATATGTAGCCTCTGGCCATCCACTGCTAAACACGTTTTAATAAACATGCC
  
3' flanking region
GAGCAAGTTGCCTGATGAGGTAAATAGGTTTTCTGCAGTGATCAAAGGGG
SNP nucleotide
AT
SNPdb format
ATATGTAGCCTCTGGCCATCCACTGCTAAACACGTTTTAATAAACATGCC[A/T]
GAGCAAGTTGCCTGATGAGGTAAATAGGTTTTCTGCAGTGATCAAAGGGG
  
Genomic location of solcap_snp_sl_100898  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18439 marker 18439
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)