SGN Marker solcap_snp_sl_100902

SGN-M18443

Synonyms  
SGN-U581948_snp16111
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54774)
Chromosome
11
Position
2.59 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ACCGGTTGCGGTGTTGCACTTGATGCTGCGACGCGAGGACTCCGGGTTGG
  
3' flanking region
TTGGTTGAGCGAGAGGATTTTGCATCTGGTACTTCTTCAAGGTCTACTAA
SNP nucleotide
AG
SNPdb format
ACCGGTTGCGGTGTTGCACTTGATGCTGCGACGCGAGGACTCCGGGTTGG[A/G]
TTGGTTGAGCGAGAGGATTTTGCATCTGGTACTTCTTCAAGGTCTACTAA
  
Genomic location of solcap_snp_sl_100902  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18443 marker 18443
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)