SGN Marker solcap_snp_sl_100904

SGN-M18445

Synonyms  
SGN-U581948_snp19882
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70470)
Chromosome
11
Position
18.83 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66998)
Chromosome
11
Position
18.73 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54776)
Chromosome
11
Position
2.59 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AAAGATGAGGGTGATGGTAGAATAATTGGTGCACGTATTCGGAATAATTT
  
3' flanking region
TCAGGTACTTCATGAATTTTATTGTAGAATTTGTGTTCCTACTCAGTTCC
SNP nucleotide
AG
SNPdb format
AAAGATGAGGGTGATGGTAGAATAATTGGTGCACGTATTCGGAATAATTT[A/G]
TCAGGTACTTCATGAATTTTATTGTAGAATTTGTGTTCCTACTCAGTTCC
  
Genomic location of solcap_snp_sl_100904  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18445 marker 18445
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)