SGN Marker solcap_snp_sl_100911

SGN-M18451

Synonyms  
SGN-U583314_snp30412
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70474)
Chromosome
9
Position
72.12 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54782)
Chromosome
9
Position
67.27 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AAACACTTGTTATAAAAAGGTGTAACCACCTCAAGGAGATCCCCCTTAGC
  
3' flanking region
TTGCTGATATTCCAACACTGAAGCAGATTAAGTTGATTAGGTGCGAGAAC
SNP nucleotide
TG
SNPdb format
AAACACTTGTTATAAAAAGGTGTAACCACCTCAAGGAGATCCCCCTTAGC[T/G]
TTGCTGATATTCCAACACTGAAGCAGATTAAGTTGATTAGGTGCGAGAAC
  
Genomic location of solcap_snp_sl_100911  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18451 marker 18451
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)