Notice: The SGN server upgrade is complete. Please let us know if you find any issues. :-)

SGN Marker solcap_snp_sl_100914

SGN-M18454

Synonyms  
SGN-U584284_snp3414
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54785)
Chromosome
2
Position
45.58 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTCCAAGAAACTTCTCCGATTACTCTCCATTTGCAAAATTTAACGACTTG
  
3' flanking region
TTATAAGCCGAGTTAGGGTTTTGAACAGTTGTAATTTTTTTTAATGGAGG
SNP nucleotide
TC
SNPdb format
CTCCAAGAAACTTCTCCGATTACTCTCCATTTGCAAAATTTAACGACTTG[T/C]
TTATAAGCCGAGTTAGGGTTTTGAACAGTTGTAATTTTTTTTAATGGAGG
  
Genomic location of solcap_snp_sl_100914  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18454 marker 18454
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)