Notice: Please give us important feedback on the future of SGN using this survey: https://www.surveymonkey.com/r/VJTRHVC

SGN Marker solcap_snp_sl_100915

SGN-M18455

Synonyms  
SGN-U584335_snp747
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54786)
Chromosome
11
Position
5.49 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCAAATCCCGACTCGTCGGACTCGGAGTAAATGAAGAATAATATAGCTTT
  
3' flanking region
TTTATGTATTCCTGTTTCTAATACTAAAATATACTAAAGTTCGTTAATGG
SNP nucleotide
CG
SNPdb format
TCAAATCCCGACTCGTCGGACTCGGAGTAAATGAAGAATAATATAGCTTT[C/G]
TTTATGTATTCCTGTTTCTAATACTAAAATATACTAAAGTTCGTTAATGG
  
Related Markers  

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of solcap_snp_sl_100915  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18455 marker 18455
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)